Welcome to Laser Pointer Forums - discuss green laser pointers, blue laser pointers, and all types of lasers

Buy Site Supporter Role (remove some ads) | LPF Donations

Links below open in new window

FrozenGate by Avery

Move Over CSI :)

I found another one, but it's in Baltimore... If anyone lives close enough to pick it up, I'd pay you to harvest the argon for me... :D
 





wow, that is one amazing deal you got on a really nice ML argon. If only i had the funds to support my laser hobby like you do. *jealousy*
 
What brand of DVD burner can you find this in?

;D


WOW.

Nice find.
I didn't see that coming.
My jaw literally dropped (and I silently said "what the fuuuuu...")
 
Are you ready for this? I took the aluminum, steel, and wiring down to the recycling center today. I got almost $50 cash for the "left over" parts! The price just went down! ;)

Murudai said:
How do you keep finding all these awesome deals?

That thing's huge, I'm sure you'll find LOTS of scrap goodies hiding away in there!
Click to expand...


I was researching the uses of the laser when I came across DNA Sequencers as one use. I searched and up it popped!

There are lots of interesting electronic components. There are also some cool optics. Also the laser fan, the water pump, the water heater, three high volume "flat" fans, and the plumbing components.

The gods love me ;)

Peace,
dave
 
$50!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! :o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o:o :o :o
 
Ace82 said:
[quote author=MarioMaster link=1217914231/0#4 date=1217915000]damn lucky, a nice multiline argon + tons of other electronic bits for only $200  :o
Click to expand...

My thoughts exactly  :o !



SenKat_Stonetek said:
Nice find as usual, Dave....I am beginning to think that the Ebay disease you have spawned is spreading....
Click to expand...

I feel ya!  My friend has the same disease, we have a bran new 50" plasma for $500 (picked up in LA) He bought a $3,000 300" projector for $1000 and sold for $2000, and much more, he finds all kinds of electronics for a fraction of the cost.  Maybe if I spent as much time on ebay as I do LPF... ;D

[/quote]

My dad made a car, it was the "Challenger" model and sold it for like, $12000 on ebay.

Anyways, nice find! I want an Argon... but first I need to get AT LEAST one greenie... or blu-ray... or red... Dang I need a laser. ;D
 
Correct me if I am wrong but does it say its rated at 50 watts. That probably the input right? :-?

--hydro15
 
it says .5 WATT. Most of the argon stickers just say .50W max because they're too lazy to figure out how much it can actually do, since technically they're usually only rated at 40mW, but can sometimes do more than 200mW at full current.
 
rathat said:
Tbh, I would rather have a DNA sequencer.
Click to expand...

I VERY highly doubt that this was a working sequencer. It was far too cheap, if it was usable it would of been sold for a lot more.

And plus, what would you do with it? It would probably only output a few bp, maybe kbp. And even if you do get results...

GTACGATCTTAGCTCGTACGTAGCTCGGCGTATAGCTATTGCGATTCGGCTATGCGGCTTATATGCTATGCGCGATATAGCGATCGGCTAGTTTTGGCAGGTTTTAAAATGGTGTGTCAGATTAAAAAATGCATTGTGGGGGTTCGCTATATGCGATTTTAGAGCGCGTAAAAAAGGTCGATGCTAGCGATATGCTACGT

Now what?
 
Murudai said:
[quote author=rathat link=1217914231/20#25 date=1218062321]Tbh, I would rather have a DNA sequencer.
Click to expand...

I VERY highly doubt that this was a working sequencer. It was far too cheap, if it was usable it would of been sold for a lot more.

And plus, what would you do with it? It would probably only output a few bp, maybe kbp. And even if you do get results...

GTACGATCTTAGCTCGTACGTAGCTCGGCGTATAGCTATTGCGATTCGGCTATGCGGCTTATATGCTATGCGCGATATAGCGATCGGCTAGTTTTGGCAGGTTTTAAAATGGTGTGTCAGATTAAAAAATGCATTGTGGGGGTTCGCTATATGCGATTTTAGAGCGCGTAAAAAAGGTCGATGCTAGCGATATGCTACGT

Now what? [/quote]
Go "coooool" and smoke a fat one...
 
You must log in or register to reply here.





Back
Top