Welcome to Laser Pointer Forums - discuss green laser pointers, blue laser pointers, and all types of lasers



Laser Pointer Store

Move Over CSI :)

Chad

New member
Joined
Jan 20, 2008
Messages
795
Likes
1
Points
0
I found another one, but it's in Baltimore... If anyone lives close enough to pick it up, I'd pay you to harvest the argon for me... :D
 

Joined
Jul 17, 2008
Messages
601
Likes
0
Points
0
wow, that is one amazing deal you got on a really nice ML argon. If only i had the funds to support my laser hobby like you do. *jealousy*
 

RA_pierce

Well-known member
Joined
Sep 16, 2007
Messages
3,399
Likes
378
Points
83
What brand of DVD burner can you find this in?

;D


WOW.

Nice find.
I didn't see that coming.
My jaw literally dropped (and I silently said "what the fuuuuu...")
 

daguin

New member
Joined
Mar 29, 2008
Messages
16,636
Likes
622
Points
0
Are you ready for this? I took the aluminum, steel, and wiring down to the recycling center today. I got almost $50 cash for the "left over" parts! The price just went down! ;)

Murudai said:
How do you keep finding all these awesome deals?

That thing's huge, I'm sure you'll find LOTS of scrap goodies hiding away in there!

I was researching the uses of the laser when I came across DNA Sequencers as one use. I searched and up it popped!

There are lots of interesting electronic components. There are also some cool optics. Also the laser fan, the water pump, the water heater, three high volume "flat" fans, and the plumbing components.

The gods love me ;)

Peace,
dave
 

jamilm9

New member
Joined
Jan 12, 2008
Messages
1,864
Likes
16
Points
0
$50!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! :eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek::eek: :eek: :eek:
 

LRMNmeyer

New member
Joined
Jul 25, 2008
Messages
504
Likes
3
Points
0
Ace82 said:
[quote author=MarioMaster link=1217914231/0#4 date=1217915000]damn lucky, a nice multiline argon + tons of other electronic bits for only $200  :eek:
My thoughts exactly  :eek: !



SenKat_Stonetek said:
Nice find as usual, Dave....I am beginning to think that the Ebay disease you have spawned is spreading....
I feel ya!  My friend has the same disease, we have a bran new 50" plasma for $500 (picked up in LA) He bought a $3,000 300" projector for $1000 and sold for $2000, and much more, he finds all kinds of electronics for a fraction of the cost.  Maybe if I spent as much time on ebay as I do LPF... ;D

[/quote]

My dad made a car, it was the "Challenger" model and sold it for like, $12000 on ebay.

Anyways, nice find! I want an Argon... but first I need to get AT LEAST one greenie... or blu-ray... or red... Dang I need a laser. ;D
 
Joined
Feb 18, 2008
Messages
733
Likes
6
Points
0
Correct me if I am wrong but does it say its rated at 50 watts. That probably the input right? :-?

--hydro15
 

GooeyGus

New member
Joined
Mar 8, 2008
Messages
2,673
Likes
38
Points
0
it says .5 WATT. Most of the argon stickers just say .50W max because they're too lazy to figure out how much it can actually do, since technically they're usually only rated at 40mW, but can sometimes do more than 200mW at full current.
 

Murudai

New member
Joined
Apr 28, 2008
Messages
2,238
Likes
13
Points
0
rathat said:
Tbh, I would rather have a DNA sequencer.
I VERY highly doubt that this was a working sequencer. It was far too cheap, if it was usable it would of been sold for a lot more.

And plus, what would you do with it? It would probably only output a few bp, maybe kbp. And even if you do get results...

GTACGATCTTAGCTCGTACGTAGCTCGGCGTATAGCTATTGCGATTCGGCTATGCGGCTTATATGCTATGCGCGATATAGCGATCGGCTAGTTTTGGCAGGTTTTAAAATGGTGTGTCAGATTAAAAAATGCATTGTGGGGGTTCGCTATATGCGATTTTAGAGCGCGTAAAAAAGGTCGATGCTAGCGATATGCTACGT

Now what?
 

VW

New member
Joined
Mar 1, 2008
Messages
579
Likes
1
Points
0
Murudai said:
[quote author=rathat link=1217914231/20#25 date=1218062321]Tbh, I would rather have a DNA sequencer.
I VERY highly doubt that this was a working sequencer. It was far too cheap, if it was usable it would of been sold for a lot more.

And plus, what would you do with it? It would probably only output a few bp, maybe kbp. And even if you do get results...

GTACGATCTTAGCTCGTACGTAGCTCGGCGTATAGCTATTGCGATTCGGCTATGCGGCTTATATGCTATGCGCGATATAGCGATCGGCTAGTTTTGGCAGGTTTTAAAATGGTGTGTCAGATTAAAAAATGCATTGTGGGGGTTCGCTATATGCGATTTTAGAGCGCGTAAAAAAGGTCGATGCTAGCGATATGCTACGT

Now what? [/quote]
Go "coooool" and smoke a fat one...
 




Top